Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR167b-5p URS000013A25F_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (miRBase, RefSeq, ENA). Described in 4 papers. Zea mays zma-miR167b-5p sequence is a product of zma-miR167b-5p, MIR167c, miR167c-5p, miR167a, zma-miR167b, zma-miR167c-5p, MIR167b, miR167d, zma-miR167a, MIR167d, miR167, miR167d-5p, miR167c, zma-miR167a-5p, miR167b, miR167a-5p, MIR167a, zma-miR167d, zma-miR167c, miR167b-5p, zma-miR167d-5p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAAGCUGCCAGCAUGAUCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Aegilops tauschii ata-miR167a-5p
    2. Ananas comosus microRNA 167g
    3. Arabidopsis lyrata aly-miR167a-5p
    4. Arabidopsis thaliana ath-miR167b
    5. Asparagus officinalis aof-miR167a
    6. Brachypodium distachyon (stiff brome) bdi-miR167f
    7. Brassica napus (rape) bna-miR167c
    8. Brassica rapa (field mustard) bra-miR167d
    9. Carica papaya (papaya) cpa-miR167a
    10. Citrus sinensis (sweet orange) csi-miR167d-5p
    11. Corchorus capsularis (jute) sRNA CCACVL1_14458
    12. Corchorus olitorius ahy-miR167-
    13. Cucumis melo cme-miR167b
    14. Cynara cardunculus var. scolymus cca-miR167c
    15. Digitalis purpurea dpr-miR167b
    16. Glycine max (soybean) gma-miR167d
    17. Gossypium hirsutum (cotton) ghr-miR167b
    18. Helianthus annuus (common sunflower) sRNA HannXRQ_Chr10g0281965
    19. Linum usitatissimum (flax) lus-miR167e
    20. Malus domestica (apple) mdm-miR167d
    21. Manihot esculenta (cassava) mes-miR167c
    22. Medicago truncatula (barrel medic) mtr-miR167a
    23. Nicotiana tabacum (common tobacco) nta-miR167e
    24. Oryza sativa Japonica Group microRNA osa-miR167b
    25. Oryza sativa (rice) osa-miR167c-5p
    26. Populus tomentosa Pto-miR167d
    27. Populus trichocarpa (black cottonwood) ptc-miR167b
    28. Prunus persica ppe-miR167b
    29. Ricinus communis (castor bean) rco-miR167b
    30. Solanum lycopersicum sly-miR167a
    31. Solanum tuberosum stu-miR167b-5p
    32. Sorghum bicolor (sorghum) sbi-miR167i
    33. Theobroma cacao tcc-miR167b
    34. Triticum aestivum tae-miR167a
    35. Vitis vinifera (wine grape) vvi-miR167b