Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ricinus communis (castor bean) rco-miR167a URS000013A25F_3988

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Ricinus communis. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAAGCUGCCAGCAUGAUCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Aegilops tauschii ata-miR167e-5p
    2. Ananas comosus microRNA 167g
    3. Arabidopsis lyrata aly-miR167a-5p
    4. Arabidopsis thaliana ath-miR167a-5p
    5. Asparagus officinalis aof-miR167a
    6. Brachypodium distachyon bdi-miR167a
    7. Brassica napus (rape) bna-miR167c
    8. Brassica rapa bra-miR167d
    9. Carica papaya cpa-miR167b
    10. Citrus sinensis (sweet orange) csi-miR167e-5p
    11. Corchorus capsularis (jute) sRNA CCACVL1_14458
    12. Corchorus olitorius ahy-miR167-
    13. Cucumis melo (muskmelon) cme-miR167b
    14. Cynara cardunculus var. scolymus cca-miR167c
    15. Digitalis purpurea dpr-miR167b
    16. Glycine max (soybean) gma-miR167a
    17. Gossypium hirsutum (cotton) ghr-miR167a
    18. Helianthus annuus sRNA HannXRQ_Chr10g0281965
    19. Linum usitatissimum (flax) lus-miR167c
    20. Malus domestica mdm-miR167e
    21. Manihot esculenta mes-miR167c
    22. Medicago truncatula mtr-miR167a
    23. Nicotiana tabacum (common tobacco) nta-miR167d
    24. Oryza sativa Japonica Group microRNA osa-miR167b
    25. Oryza sativa (rice) osa-miR167b
    26. Populus tomentosa Pto-miR167d
    27. Populus trichocarpa (black cottonwood) ptc-miR167b
    28. Prunus persica ppe-miR167a
    29. Solanum lycopersicum sly-miR167a
    30. Solanum tuberosum (potato) stu-miR167a-5p
    31. Sorghum bicolor (sorghum) sbi-miR167a
    32. Theobroma cacao (cacao) tcc-miR167b
    33. Triticum aestivum tae-miR167a
    34. Vitis vinifera vvi-miR167d
    35. Zea mays zma-miR167a-5p