v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brassica rapa (field mustard) bra-miR167b URS000013A25F_3711

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGAAGCUGCCAGCAUGAUCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 70 other species

    1. Aegilops tauschii ata-miR167a-5p
    2. Ananas comosus (pineapple) microRNA 167g
    3. Arabidopsis lyrata aly-miR167b-5p
    4. Arabidopsis thaliana (thale cress) ath-miR167a-5p
    5. Asparagus officinalis aof-miR167a
    6. Brachypodium distachyon bdi-miR167b
    7. Brassica napus bna-miR167c
    8. Carica papaya cpa-miR167b
    9. Citrus sinensis csi-miR167d-5p
    10. Corchorus capsularis (jute) sRNA CCACVL1_14458
    11. Corchorus olitorius ahy-miR167-
    12. Cucumis melo cme-miR167a
    13. Cynara cardunculus var. scolymus cca-miR167c
    14. Digitalis purpurea dpr-miR167b
    15. Glycine max (soybean) gma-miR167b
    16. Gossypium hirsutum (cotton) ghr-miR167a
    17. Helianthus annuus (common sunflower) ath-miR167a-5p
    18. Linum usitatissimum (flax) lus-miR167h
    19. Malus domestica (apple) mdm-miR167c
    20. Manihot esculenta mes-miR167c
    21. Medicago truncatula mtr-miR167a
    22. Nicotiana tabacum nta-miR167d
    23. Oryza sativa Japonica Group microRNA osa-miR167b
    24. Oryza sativa (rice) osa-miR167a-5p
    25. Populus tomentosa Pto-miR167d
    26. Populus trichocarpa ptc-miR167b
    27. Prunus persica ppe-miR167b
    28. Ricinus communis rco-miR167a
    29. Solanum lycopersicum (tomato) sly-miR167a
    30. Solanum tuberosum (potato) stu-miR167a-5p
    31. Sorghum bicolor sbi-miR167b
    32. Theobroma cacao tcc-miR167b
    33. Triticum aestivum tae-miR167a
    34. Vitis vinifera (wine grape) vvi-miR167d
    35. Zea mays zma-miR167a-5p
     Publications