Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-200b-5p URS000012A1DD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-200b: Hsa-mir-200b is a microRNA that has been studied in relation to RNA editing levels and its effects on cell lines [PMC4793219]. Previous studies have visualized hsa-mir-200b and found that its expression tendency is similar to other miRNAs, such as hsa-miR-21, hsa-miR-155, and hsa-miR-221 [PMC4525332] [PMC2687417]. The hypothesis was that cell lines with higher RNA editing levels would be less affected by hsa-mir-200b [PMC4793219]. The expression tendency of these miRNAs, including hsa-mir-200b, was found to be similar in the current study compared to previous studies [PMC2687417].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCUUACUGGGCAGCAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Publications