v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4466739 URS000012A1DD_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAUCUUACUGGGCAGCAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Canis lupus familiaris cfa-miR-200b
  2. Cavia porcellus (domestic guinea pig) cpo-miR-200b-5p
  3. Chrysemys picta (Painted turtle) cpi-miR-200b-5p
  4. Columba livia cli-miR-200b-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-200b-5p
  6. Homo sapiens (human) hsa-miR-200b-5p
  7. Macaca fascicularis (crab-eating macaque) microRNA miR-200b-5p
  8. Mus musculus mmu-miR-200b-5p
  9. Rattus norvegicus (Norway rat) rno-miR-200b-5p