Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-200b-5p URS000012A1DD_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-200b: Rno-mir-200b is a rat miRNA that is a homolog of the human miRNA hsa-miR-200b [PMC4693154]. It has been identified as an early marker for the prediction of a carcinogenic potential [PMC4022579]. Rno-mir-200b is part of the miR-200 family, along with rno-miR-200a and rno-miR-200c, which have slight sequence variations compared to rno-mir-200b [PMC3895276]. Rno-mir-200b and rno-miR-429 have been predicted to target Zeb1, a gene associated with cancer [PMC8914318]. In an experiment with CCI rats, the expression of Zeb1 was significantly increased, while the expression of rno-mir-200b and rno-miR-429 was notably downregulated [PMC8914318]. However, overexpression of rno-mir-200b and rno-miR-429 led to a significant inhibition of Zeb1 mRNA expression in rats [PMC8914318]. These findings suggest that rno-mir-200b may play a role in cancer development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCUUACUGGGCAGCAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Publications