Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3617-5p URS000012846D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3617: Hsa-mir-3617 is one of the 14 miRNAs identified in the network of pathways for HER2 BC [PMC5123339]. However, there is currently no publication available regarding the function of hsa-mir-3617 in any biological processes [PMC5123339]. In a study on SVR-LUAD-8 and SVR-LUAD-5, hsa-mir-3617 was found to be one of the miRNAs that do not belong to the 18-miRNA signature [PMC5548864]. Hsa-mir-3617, along with hsa-miR-3614-3p, is associated with the T2DM pathway and mitogen-activated protein kinase (MAPK) pathway [PMC6108858]. Further experiments are needed to confirm the predicted connection between circANKRD36 and miRNAs, including hsa-mir-3617 and hsa-miR-3614-3p [PMC6108858]. CircANKRD36 harbors several miRNAs including hsa-mir-3617 [PMC6108858].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGACAUAGUUGCAAGAUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta Mml-Mir-3617_5p (mature (guide))
  2. Pongo pygmaeus ppy-miR-3617
Publications