Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR166l-3p URS0000127C0D_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (ENA, miRBase, RefSeq). Described in 4 papers. Zea mays zma-miR166l-3p sequence is a product of miR166m-3p, zma-miR166l-3p, MIR166m, zma-miR166m-3p, miR166l, miR166, miR166m, zma-miR166l, zma-miR166m, MIR166l, miR166l-3p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGGACCAGGCUUCAUUCCUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Ananas comosus microRNA 166d
    2. Aquilegia coerulea aqc-miR166a
    3. Cucumis melo (muskmelon) cme-miR166e
    4. Cynara cardunculus var. scolymus cca-miR166a
    5. Digitalis purpurea dpr-miR166a
    6. Helianthus annuus sRNA HannXRQ_Chr05g0160785
    7. Linum usitatissimum (flax) lus-miR166e
    8. Medicago truncatula mtr-miR166f
    9. Oryza sativa Japonica Group microRNA osa-miR166h-3p
    10. Oryza sativa (rice) osa-miR166h-3p
    11. Picea abies pab-miR166a
    12. Salvia sclarea (clary) ssl-miR166a
    13. Solanum lycopersicum sly-miR166c-3p
    14. Solanum tuberosum (potato) stu-miR166b
    15. Sorghum bicolor (sorghum) sbi-miR166f
    16. Theobroma cacao (cacao) tcc-miR166c