Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-376a-3p URS0000126D1F_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-376a: Rno-mir-376a is a microRNA that has been studied in the context of islet stimulation and ovarian regulation. In the Wistar islet, there are three observed trends in miRNA expression changes upon stimulation, including increasing levels of rno-mir-376a [PMC3072418]. However, in the GK islet, there are failures in achieving normal levels of miRNAs, including rno-mir-376a [PMC3072418]. Rno-mir-376a has been found to decrease GRP78 protein production by translational repression without altering GRP78 mRNA levels [PMC4184830]. It has also been shown to bind to the 3'-end of GRP78 mRNA and block its translation [PMC4184830]. Rno-mir-376a expression is induced by hCG and leads to repression of GRP78 translation [PMC4184830]. In granulosa cells, rno-mir-376a has a significant impact on the regulation of GRP78 protein expression but not gene expression [PMC4184830]. It has been identified as one of several miRNAs that bind to the 3'-UTR of GRP78 mRNA and may constitute a network involved in its regulation [PMC4184830]. The luciferase activity in cells transfected with a reporter vector containing the putative rno-mir-376a binding site was reduced by approximately 50% after transfection with precursor [PMC4184830]. Rno-miR-144, rno-mir-376a, and rno-miR-451 have also been studied for their effects on GRP78 mRNA expression in granulosa cells isolated from DES-treated rats [PMC4184830].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCGUAGAGGAAAAUCCACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications