Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3198 URS000012568D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-3198: Hsa-mir-3198 is a microRNA that has been studied in various contexts. In one study, it was found that QPCR resulted in multiple products for several candidates, including hsa-mir-3198, making it difficult to determine their overexpression in the ovary [PMC5223123]. However, other studies have identified hsa-mir-3198 as one of the most significantly differentially expressed miRNAs. It has been found to be downregulated in saliva samples [PMC8742548]. Hsa-mir-3198 has also been implicated in hepatocellular carcinoma recurrence, epithelial ovarian cancer, metastatic colorectal cancer, and inhibition of nasopharyngeal carcinoma proliferation [PMC8742548]. In a study on the effects of cigarette smoking on miRNA expression, hsa-mir-3198 was found to be downregulated in nicotine-treated periodontal ligament stem cells (PDLSC) [PMC5379007]. However, its expression trend was opposite to that observed in smoker PDLSCs with reduced regenerative potential [PMC5379007]. Hsa-mir-3198 has also been identified as one of the "low-5" miRNAs with low activation scores among all human miRNAs [PMC8677043]. Additionally, it has been shown to interact with several other miRNAs and mRNAs [PMC9428625]. Overall, hsa-mir-3198 is a microRNA that exhibits differential expression and potential functional roles in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGAGUCCUGGGGAAUGGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications