Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-146a-3p URS0000121576_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-146a: Sequencing analysis showed that the genome editing activities were confirmed at a rate of 8.2% (4 mutated sequences out of 48 sequences) for mmu-mir-146a [PMC3797721]. Mmu-mir-146a levels were measured in adipocyte and SVF fractions using miRCURY LNA RT PCR [PMC6395003]. Mmu-mir-146a is one of the up-regulated miRNAs in HFD-induced obesity [PMC3319598]. It was found to bind to the 3'UTR region of 14 potential target genes [PMC8293491]. Mmu-mir-146a was also associated with immune-related signaling molecules Traf6 and Irak1 and showed upregulation upon CS exposure [PMC7218232]. Additionally, it was marginally significantly associated with postoperative cognitive dysfunction (POCD) [PMC6704709]. A specific sequence for mmu-mir-146a (5′-CUGAGAACUGAAUUCCAUGGGUUAUAUCAAUGUCA-3′) was purchased for experimentation purposes [PMC4346627].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGUGAAAUUCAGUUCUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta (Rhesus monkey) mml-miR-146a-3p
  2. Pteropus alecto pal-miR-146a-3p
Publications