Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-294-5p URS000011FA9E_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-294: Mmu-mir-294 is a miRNA mimic that was transfected in a study described in [PMC2958809]. It is part of the mmu-miR-290-295 cluster, which has been shown to play a role in pluripotency regulation [PMC9149258]. In various experiments, mmu-mir-294 was found to be highly expressed, along with other miRNAs from the cluster [PMC3287988]. Mmu-mir-294 has been shown to promote pluripotency by regulating c-Myc target genes and upregulating pluripotency-associated genes such as Lin 28 [PMC9149258]. It has also been implicated in the post-transcriptional regulation of Cdkn1a [PMC9149258]. Detection of mmu-mir-294 can be improved using EDC cross-linking compared to UV cross-linking [PMC1885651]. Mmu-mir-294 is predicted to target the activin receptor 1 (ACVR1) gene, along with other miRNAs from the cluster [PMC4499447]. It belongs to the AAGUGCU seed family, which includes other miRNAs such as mmu-miR-291a-3p and mmu-miR-295 [PMC4132708].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCAAAAUGGAGGCCCUAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications