Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Thalassolituus oleivorans MIL-1 5S ribosomal RNA secondary structure diagram

Thalassolituus oleivorans MIL-1 5S ribosomal RNA URS000011E7D0_1298593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGACGACAAUAGAGCUGUGGAACCACCUGAAUCCAUUCCGAACUCAGAAGUGAAACGCAGUAUCGCCGAUGGUAGUGUGGGGCCUCCCCAUGCGAGAGUAGGUCAUCGUCAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Thalassobium sp. 5S ribosomal RNA
  2. Thalassolituus oleivorans 5S ribosomal RNA
  3. Thalassolituus oleivorans R6-15 5S ribosomal RNA
2D structure Publications