Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae (baker's yeast) tRNA-Trp gene, anticodon, cca, potential intron between positions 12453 12420, len: 106 secondary structure diagram

Saccharomyces cerevisiae (baker's yeast) tRNA-Trp gene, anticodon, cca, potential intron between positions 12453 12420, len: 106 URS0000116720_4932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGCGGUGGCUCAAUGGUAGAGCUUUCGACUCCAAUUAAAUCUUGGAAAUUCCACGGAAUAAGAUUGCAAUCGAAGGGUUGCAGGUUCAAUUCCUGUCCGUUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Fusarium falciforme tRNA-Trp
  2. Saccharomyces cerevisiae AWRI796 tRNA
  3. Saccharomyces cerevisiae EC1118 tRNA-Trp
  4. Saccharomyces cerevisiae FostersB tRNA
  5. Saccharomyces cerevisiae FostersO tRNA
  6. Saccharomyces cerevisiae Lalvin QA23 tRNA
  7. Saccharomyces cerevisiae P301 tRNA-Trp
  8. Saccharomyces cerevisiae R008 tRNA-Trp
  9. Saccharomyces cerevisiae R103 tRNA-Trp
  10. Saccharomyces cerevisiae RM11-1a tRNA-Trp
  11. Saccharomyces cerevisiae S288C tRNA-Trp
  12. Saccharomyces cerevisiae Vin13 tRNA
  13. Saccharomyces cerevisiae VL3 tRNA
  14. Saccharomyces pastorianus tRNA-Trp
2D structure