v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 5S ribosomal RNA secondary structure diagram

Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 5S ribosomal RNA URS0000114E45_342451

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUGGUGACAAUGGCAAGGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCCUUAGCGCCGAUGGUAGUCGGACUUACGUUCCGCAAGAGUAGGACGUUGCCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Nocardia seriolae 5S ribosomal RNA
  2. Staphylococcus arlettae 5S ribosomal RNA
  3. Staphylococcus edaphicus 5S ribosomal RNA
  4. Staphylococcus gallinarum 5S rRNA
  5. Staphylococcus pragensis 5S ribosomal RNA
  6. Staphylococcus saprophyticus (gut metagenome) 5S ribosomal RNA
  7. Staphylococcus saprophyticus 5S ribosomal RNA
  8. Staphylococcus saprophyticus 5S ribosomal RNA
  9. Staphylococcus simulans 5S ribosomal RNA
  10. Staphylococcus sp. GSSP0090 5S ribosomal RNA
  11. Staphylococcus sp. HMSC068H12 5S ribosomal RNA
 2D structure Publications