Homo sapiens (human) hsa-miR-3615

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3615 URS000011166D_9606

21 nucleotides
7 databases (ENA, GeneCards, LncBase, MalaCards, miRBase, RefSeq, TarBase)
Found in 0 other species
128 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3615: Hsa-mir-3615 is a microRNA (miRNA) that has been reported to regulate relevant genes associated with oxidative stress injuries in retinal pigment epithelial (RPE) cells [PMC7222416]. A risk score calculated using hsa-mir-3615, along with six other miRNAs and two combinations of clinical factors, showed promising predictive value for certain conditions [PMC8176021]. In a study examining the expression levels of various miRNAs, hsa-mir-3615 was found to have an intermediate level of expression compared to other miRNAs [PMC7940945]. Additionally, hsa-mir-3615 was identified as one of the miRNAs in the "only-C-Down" set in a specific analysis [PMC10009568]. References: [PMC7222416]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7222416/ [PMC8176021]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8176021/ [PMC7940945]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7940945/ [PMC10009568]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10009568/

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UCUCUCGGCUCCUCGCGGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications