Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-988-3p URS0000110829_7227

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Drosophila melanogaster. Annotated by 6 databases (FlyBase, MirGeneDB, PirBase, miRBase, ENA, RefSeq). Described in 13 papers. Drosophila melanogaster (fruit fly) dme-miR-988-3p sequence is a product of miR-988-3p, mir-988, 988-RA, dme-miR-988-3p, 988-R, dme-miR-988, mir-988-RA, miR-988, FBgn0262300 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCCCUUGUUGCAAACCUCACGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 9 other species

    1. Aedes aegypti aae-miR-988-3p
    2. Anopheles gambiae (African malaria mosquito) aga-miR-988
    3. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-988-3p
    4. Dasypus novemcinctus Dan-Mir-988_3p (mature (guide))
    5. Drosophila mojavensis Dmo-Mir-988_3p (mature (guide))
    6. Drosophila pseudoobscura dps-miR-988-3p
    7. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330858_df_nrg
    8. Drosophila simulans dsi-miR-988-3p
    9. Drosophila virilis dvi-miR-988-3p
    10. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-10873816