Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-10873816 URS0000110829_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCCUUGUUGCAAACCUCACGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-988-3p
  2. Anopheles gambiae aga-miR-988
  3. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-988-3p
  4. Drosophila ananassae Dan-Mir-988_3p (mature (guide))
  5. Drosophila melanogaster dme-miR-988-3p
  6. Drosophila mojavensis Dmo-Mir-988_3p (mature (guide))
  7. Drosophila pseudoobscura dps-miR-988-3p
  8. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330858_df_nrg
  9. Drosophila simulans dsi-miR-988-3p
  10. Drosophila virilis dvi-miR-988-3p
  11. Drosophila yakuba Dya-Mir-988_3p (mature (guide))