Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1537-3p URS000010F787_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1537: Hsa-mir-1537 is a dysregulated wb-miRNA that is common to all four pairwise comparisons [PMC7880712]. Limited data is available for this miRNA, with few publications describing its alteration in the serum and bile of cholangioma patients [PMC5123339]. It has been speculated that hsa-mir-1537 may have a role in inflammation [PMC5123339]. In BC luminal A, hsa-mir-1537 is one of the 11 miRNAs identified that could be key modulators of various pathways, including Intrinsic Prothrombin Activation, Extrinsic Prothrombin Activation, Acute Phase Response Signalling, HIF1 Signalling, Axonal Guidance Signalling, Glioma Invasiveness Signalling, Ethanol Degradation IV, and Estrogen Receptor Signalling [PMC5123339]. Additionally, hsa-mir-1537 has been found in the network of pathways for BC luminal A [PMC5123339]. However, in bile samples from patients with primary sclerosing cholangitis (PSC) and PSC/cholangiocarcinoma (CCA), hsa-mir-1537 was downregulated along with hsa-miR-640 and hsa-miR-3189. Conversely, hsa-miR-412 was upregulated in these patients [PMC5223017].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAACCGUCUAGUUACAGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications