Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta (Rhesus monkey) microRNA mml-mir-106b precursor secondary structure diagram

Macaca mulatta (Rhesus monkey) microRNA mml-mir-106b precursor URS000010A46C_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGCUGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCCGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications