v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Brevibacillus brevis NBRC 100599 5S ribosomal RNA secondary structure diagram

Brevibacillus brevis NBRC 100599 5S ribosomal RNA URS000010448F_358681

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUGGUGAUGAUGGCGGAGGGGACACACCCGUUCCCAUGCCGAACACGGCCGUUAAGCCCUCCAGCGCCGAUGGUACUUGCUCCGCAGGGAGCCGGGAGAGUAGGACGUUGCCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bacillus sp. FJAT-27238 5S ribosomal RNA
  2. Brevibacillus brevis 5S rRNA
  3. Brevibacillus brevis X23 5S ribosomal RNA
  4. Brevibacillus formosus 5S rRNA
  5. Brevibacillus panacihumi 5S rRNA
  6. Brevibacillus panacihumi W25 5S ribosomal RNA
  7. Brevibacillus sp. AG162 5S ribosomal RNA
  8. Brevibacillus sp. BC25 5S ribosomal RNA
  9. Brevibacillus porteri 5S ribosomal RNA
  10. Brevibacillus sp. NRRL NRS-603 5S ribosomal RNA
  11. Brevibacillus antibioticus 5S ribosomal RNA
  12. uncultured Brevibacillus sp. 5S rRNA
 2D structure Publications