Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000103F8F_559292

Automated summary: This snoRNA sequence is 91 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (RefSeq, Rfam, ENA, IntAct, SGD). Described in 27 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snoR53, RF00338). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR53 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 1

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

IntAct ID Participant Synonyms
EBI-15097635 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUGAUGAUGAUUACACUCCAUGCUAAUCAUGAACGUGUUCGAUGUAAAUUUGAAUACGAUGAUUAAAAUUGUUGUUUACGCUUUCUGAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Marmota marmota marmota snoRNA
    2. Saccharomyces cerevisiae small nucleolar RNA snR53
    3. Saccharomyces cerevisiae EC1118 SNR53
    4. Saccharomyces cerevisiae FostersB Small nucleolar RNA snR53
    5. Saccharomyces cerevisiae Kyokai no. 7 K7_snR53
    6. Saccharomyces cerevisiae PE-2 SNR53
    7. Saccharomyces cerevisiae YJM1078 SNR53
    8. Saccharomyces cerevisiae YJM1242 SNR53
    9. Saccharomyces cerevisiae YJM1248 SNR53
    10. Saccharomyces cerevisiae YJM1252 SNR53
    11. Saccharomyces cerevisiae YJM1273 SNR53
    12. Saccharomyces cerevisiae YJM1342 SNR53
    13. Saccharomyces cerevisiae YJM1356 SNR53
    14. Saccharomyces cerevisiae YJM1386 SNR53
    15. Saccharomyces cerevisiae YJM1387 SNR53
    16. Saccharomyces cerevisiae YJM1402 SNR53
    17. Saccharomyces cerevisiae YJM1419 SNR53
    18. Saccharomyces cerevisiae YJM1434 SNR53
    19. Saccharomyces cerevisiae YJM1439 SNR53
    20. Saccharomyces cerevisiae YJM1460 SNR53
    21. Saccharomyces cerevisiae YJM1477 SNR53
    22. Saccharomyces cerevisiae YJM1526 SNR53
    23. Saccharomyces cerevisiae YJM1527 SNR53
    24. Saccharomyces cerevisiae YJM1549 SNR53
    25. Saccharomyces cerevisiae YJM1573 SNR53
    26. Saccharomyces cerevisiae YJM195 SNR53
    27. Saccharomyces cerevisiae YJM248 SNR53
    28. Saccharomyces cerevisiae YJM627 SNR53
    2D structure New