Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000103348_559292

  • 96 nucleotides
  • 5 databases (ENA, IntAct, RefSeq, Rfam, SGD)
  • Found in 102 species

Automated summary: This snoRNA sequence is 96 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (SGD, RefSeq, Rfam, ENA, IntAct). Described in 26 papers. Matches 1 Rfam family (snR58, RF01199). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR58 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 1

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11793488 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUUAUGAUGAUAUUCUUUACGAACUUUUAGACGUUAGACUUCUGAAGGAGAUUAGACCCUCCUAUGGAAGAGAAACUCGUUAAACUUAUCUGAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 101 other species

    1. Saccharomyces cerevisiae AWRI796 Small nucleolar RNA snR58
    2. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR58
    3. Saccharomyces cerevisiae EC1118 SNR58
    4. Saccharomyces cerevisiae FostersB Small nucleolar RNA snR58
    5. Saccharomyces cerevisiae FostersO Small nucleolar RNA snR58
    6. Saccharomyces cerevisiae Kyokai no. 7 K7_snR58
    7. Saccharomyces cerevisiae Lalvin QA23 Small nucleolar RNA snR58
    8. Saccharomyces cerevisiae P283 SNR58
    9. Saccharomyces cerevisiae P301 SNR58
    10. Saccharomyces cerevisiae PE-2 SNR58
    11. Saccharomyces cerevisiae R008 SNR58
    12. Saccharomyces cerevisiae R103 SNR58
    13. Saccharomyces cerevisiae Vin13 Small nucleolar RNA snR58
    14. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR58
    15. Saccharomyces cerevisiae YJM1078 SNR58
    16. Saccharomyces cerevisiae YJM1129 SNR58
    17. Saccharomyces cerevisiae YJM1133 SNR58
    18. Saccharomyces cerevisiae YJM1190 SNR58
    19. Saccharomyces cerevisiae YJM1199 SNR58
    20. Saccharomyces cerevisiae YJM1202 SNR58
    21. Saccharomyces cerevisiae YJM1208 SNR58
    22. Saccharomyces cerevisiae YJM1242 SNR58
    23. Saccharomyces cerevisiae YJM1244 SNR58
    24. Saccharomyces cerevisiae YJM1248 SNR58
    25. Saccharomyces cerevisiae YJM1250 SNR58
    26. Saccharomyces cerevisiae YJM1252 SNR58
    27. Saccharomyces cerevisiae YJM1273 SNR58
    28. Saccharomyces cerevisiae YJM1304 SNR58
    29. Saccharomyces cerevisiae YJM1307 SNR58
    30. Saccharomyces cerevisiae YJM1311 SNR58
    31. Saccharomyces cerevisiae YJM1326 SNR58
    32. Saccharomyces cerevisiae YJM1332 SNR58
    33. Saccharomyces cerevisiae YJM1336 SNR58
    34. Saccharomyces cerevisiae YJM1341 SNR58
    35. Saccharomyces cerevisiae YJM1342 SNR58
    36. Saccharomyces cerevisiae YJM1356 SNR58
    37. Saccharomyces cerevisiae YJM1381 SNR58
    38. Saccharomyces cerevisiae YJM1383 SNR58
    39. Saccharomyces cerevisiae YJM1385 SNR58
    40. Saccharomyces cerevisiae YJM1386 SNR58
    41. Saccharomyces cerevisiae YJM1387 SNR58
    42. Saccharomyces cerevisiae YJM1388 SNR58
    43. Saccharomyces cerevisiae YJM1389 SNR58
    44. Saccharomyces cerevisiae YJM1400 SNR58
    45. Saccharomyces cerevisiae YJM1401 SNR58
    46. Saccharomyces cerevisiae YJM1402 SNR58
    47. Saccharomyces cerevisiae YJM1415 SNR58
    48. Saccharomyces cerevisiae YJM1417 SNR58
    49. Saccharomyces cerevisiae YJM1418 SNR58
    50. Saccharomyces cerevisiae YJM1419 SNR58
    51. Saccharomyces cerevisiae YJM1433 SNR58
    52. Saccharomyces cerevisiae YJM1434 SNR58
    53. Saccharomyces cerevisiae YJM1439 SNR58
    54. Saccharomyces cerevisiae YJM1444 SNR58
    55. Saccharomyces cerevisiae YJM1447 SNR58
    56. Saccharomyces cerevisiae YJM1460 SNR58
    57. Saccharomyces cerevisiae YJM1463 SNR58
    58. Saccharomyces cerevisiae YJM1477 SNR58
    59. Saccharomyces cerevisiae YJM1478 SNR58
    60. Saccharomyces cerevisiae YJM1479 SNR58
    61. Saccharomyces cerevisiae YJM1526 SNR58
    62. Saccharomyces cerevisiae YJM1527 SNR58
    63. Saccharomyces cerevisiae YJM1549 SNR58
    64. Saccharomyces cerevisiae YJM1573 SNR58
    65. Saccharomyces cerevisiae YJM1574 SNR58
    66. Saccharomyces cerevisiae YJM1592 SNR58
    67. Saccharomyces cerevisiae YJM1615 SNR58
    68. Saccharomyces cerevisiae YJM189 SNR58
    69. Saccharomyces cerevisiae YJM193 SNR58
    70. Saccharomyces cerevisiae YJM195 SNR58
    71. Saccharomyces cerevisiae YJM244 SNR58
    72. Saccharomyces cerevisiae YJM248 SNR58
    73. Saccharomyces cerevisiae YJM270 SNR58
    74. Saccharomyces cerevisiae YJM271 SNR58
    75. Saccharomyces cerevisiae YJM320 SNR58
    76. Saccharomyces cerevisiae YJM326 SNR58
    77. Saccharomyces cerevisiae YJM428 SNR58
    78. Saccharomyces cerevisiae YJM450 SNR58
    79. Saccharomyces cerevisiae YJM451 SNR58
    80. Saccharomyces cerevisiae YJM453 SNR58
    81. Saccharomyces cerevisiae YJM456 SNR58
    82. Saccharomyces cerevisiae YJM470 SNR58
    83. Saccharomyces cerevisiae YJM541 SNR58
    84. Saccharomyces cerevisiae YJM554 SNR58
    85. Saccharomyces cerevisiae YJM555 SNR58
    86. Saccharomyces cerevisiae YJM627 SNR58
    87. Saccharomyces cerevisiae YJM681 SNR58
    88. Saccharomyces cerevisiae YJM682 SNR58
    89. Saccharomyces cerevisiae YJM683 SNR58
    90. Saccharomyces cerevisiae YJM689 SNR58
    91. Saccharomyces cerevisiae YJM693 SNR58
    92. Saccharomyces cerevisiae YJM969 SNR58
    93. Saccharomyces cerevisiae YJM972 SNR58
    94. Saccharomyces cerevisiae YJM975 SNR58
    95. Saccharomyces cerevisiae YJM978 SNR58
    96. Saccharomyces cerevisiae YJM981 SNR58
    97. Saccharomyces cerevisiae YJM984 SNR58
    98. Saccharomyces cerevisiae YJM987 SNR58
    99. Saccharomyces cerevisiae YJM990 SNR58
    100. Saccharomyces cerevisiae YJM993 SNR58
    101. Saccharomyces cerevisiae YJM996 SNR58