Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila sechellia microRNA dse-mir-307 precursor secondary structure diagram

Drosophila sechellia microRNA dse-mir-307 precursor URS00000FFDD9_7238

Automated summary: This pre miRNA sequence is 88 nucleotides long and is found in Drosophila sechellia. Annotated by 3 databases (ENA, miRBase, Ensembl Metazoa). Described in 2 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-67, RF00844). Drosophila sechellia microRNA dse-mir-307 precursor sequence is a product of 307 precursor RNA, Dsec\mir-307, FBgn0255216, mir-307 precursor RNA, 307 precursor RN genes. Found in the Drosophila sechellia reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUCUUGCUUUGACUCACUCAACCUGGGUGUGAUGUUAUUUCGAUAUGGUAUCCAUCACAACCUCCUUGAGUGAGCGAUAGCAGGACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 4 other species

    2D structure New