Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) microRNA dme-miR-307a-3p URS00000FBB5F_7227

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Drosophila melanogaster. Annotated by 1 database (ENA). Described in 1 paper. Drosophila melanogaster (fruit fly) microRNA dme-miR-307a-3p sequence is a product of miR-307, miR-307a, dme-miR-307a-3p, dme-miR-307a, miR-307a-3p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCACAACCUCCUUGAGUGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Anopheles gambiae aga-miR-307
    2. Bombyx mori (domestic silkworm) bmo-miR-307-3p
    3. Daphnia pulex dpu-miR-307
    4. Drosophila ananassae dan-miR-307
    5. Drosophila erecta der-miR-307
    6. Drosophila grimshawi dgr-miR-307
    7. Drosophila mojavensis dmo-miR-307
    8. Drosophila persimilis dpe-miR-307
    9. Drosophila pseudoobscura dps-miR-307a
    10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294437_df_nrg
    11. Drosophila sechellia dse-miR-307
    12. Drosophila simulans dsi-miR-307
    13. Drosophila willistoni dwi-miR-307
    14. Drosophila yakuba dya-miR-307
    15. Ixodes scapularis (black-legged tick) isc-miR-307
    16. Tribolium castaneum (red flour beetle) tca-miR-307-3p