Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-93-3p URS00000FB1B1_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-93: Mmu-mir-93 is a microRNA that has been found to be upregulated in various studies [PMC6806364]. In one study, the upregulation of mmu-mir-93 was observed in donors 2 and 3, and it was significantly associated with the exposure-time product of electromagnetic fields [PMC7904780]. Transfection of mmu-mir-93 in 3T3-L1 cells resulted in a significant increase in its expression [PMC3712080]. Furthermore, cells transfected with mmu-mir-93 mimics showed reduced levels of IL-1β and TNF-α, while cells transfected with mmu-mir-93 inhibitor showed elevated levels of these cytokines [PMC5585731]. The expression of IRAK4, a target gene of mmu-mir-93, was found to be significantly lower in cells transfected with mmu-mir-93 mimics and higher in cells transfected with mmu-mir-93 inhibitor [PMC5585731]. In another study, the downregulation of mmu-miR-106b, which is a member of the miR-106b~25 cluster that includes mmu-miR-25 and mmu-mir-93, was observed in DIO mice [PMC4571067]. The expression levels of miR 106b and miR 17 were measured using real-time RT-qPCR assays [PMC7473303]. Overall, these findings suggest that mmu-mir-93 plays a role in various biological processes and may have implications for disease development [PMC6806364].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGCUGAGCUAGCACUUCCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Homo sapiens hsa-miR-93-3p
  2. Macaca mulatta mml-miR-93-3p
  3. Pteropus alecto (black flying fox) pal-miR-93-3p
Publications