Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-503-5p URS00000F6E49_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-503: Hsa-mir-503 is a microRNA that has been found to be significantly up-regulated in male tumors, while in female breast cancer (FBC) it has been shown to be down-regulated [PMC5820911]. In a study comparing three different groups, hsa-mir-503 was found to be shared by all three groups [PMC3462109]. Additionally, several other microRNAs were found to be significantly up-regulated in male tumors, including hsa-miR-135b-5p, hsa-miR-1180, hsa-miR-9-5p, hsa-miR-34a-5p, hsa-miR-362-5p, hsa-mir-181c-5p, hsa-miR-25-3p, hsa-miR125a, hsa-miR4245p and hasmi-R4255p [PMC5820911]. These microRNAs have shown different expression patterns in FBC [PMC5820911]. The study also found that there were varying numbers of shared microRNAs between the different groups: 3 miRNAs were shared by all three groups and 5 miRNAs were shared between the first two groups while 10 and 13 miRNAs were shared between the first and third group and the second and third group respectively [PMC3462109]. These findings suggest that there are distinct expression patterns of microRNAs in male tumors compared to FBC.

mRNA interactions 10 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCGGGAACAGUUCUGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Gorilla gorilla gorilla ggo-miR-503 (MIR503)
  2. Gorilla gorilla (western gorilla) ggo-miR-503
  3. Macaca mulatta (Rhesus monkey) mml-miR-503-5p
  4. Pan troglodytes ptr-miR-503
  5. Pongo pygmaeus ppy-miR-503
Publications