Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-642a-5p URS00000F2C33_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

Hsa-Mir-642: Hsa-mir-642 is a specific microRNA that is present in extracellular vesicles (EVs) derived from activated NCFs and has been linked to breast cancer [PMC7381355] [PMC7929672]. It is also an adipocyte-specific microRNA and may be associated with metabolic parameters such as Body Mass Index, blood cholesterol and fatty acids levels, and insulin resistance [PMC3945012]. Analysis of hsa-mir-642 in a population of 100 healthy subjects revealed two distinct groups with high or low/undetectable levels of hsa-mir-642 [PMC3945012]. Gender-driven differences showed higher expression of hsa-miR-10b and hsa-mir-642 in males compared to females [PMC3945012]. Various assays, inhibitors, and probes have been used to study hsa-mir-642 in different contexts [PMC3473298] [PMC8533892] [PMC5042920]. Hsa-mir-642 has also been found to be differentially expressed in pancreatic neuroendocrine tumors (PNETs) compared to pancreatic ductal adenocarcinomas (PDACs) [PMC7352720]. In osteosarcoma patients, high expression of hsa-mir-642 is associated with poor prognosis, while low expression is also linked to poor prognosis for other miRNAs [PMC9553349]. Hsa-mir-642 has been identified as one of the microRNAs that show significant correlations with viral load, suggesting its potential as a biomarker for infection status [PMC8066103]. References: [PMC7381355] [PMC7929672] [PMC3945012] [PMC3473298] [PM8533892] [PM5042920] [PM7352720] [PM9553349] [PM8066103]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCCCUCUCCAAAUGUGUCUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta mml-miR-642
  2. Pan troglodytes (chimpanzee) ptr-miR-642
Publications