v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-223 URS00000F11D1_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-223: In a study on chronic lymphocytic leukemia (CLL), the expression pattern of 12 canine miRNAs, including cfa-mir-223, was analyzed [PMC3619122]. Four of these miRNAs, including cfa-mir-223, were found to have stable expression and were used as endogenous controls [PMC3619122]. Other miRNAs, such as cfa-miR-382, cfa-miR-380, cfa-miR-199, and cfa-miR-21 (including its less abundant product cfa-miR-21*), were found to be positively associated with plasma PIIINP concentration [PMC3668254]. Cfa-mir-223 was also positively associated with plasma PIIINP concentration but showed a significant elevation only from day 14 [PMC3668254]. CmiRNA panel selection included cfa-mir-223 due to its stability in serum [PMC9951723]. Cfa-mir-223 was used as a control in one study but was found to be inappropriate for normalization of RT-qPCR data in the context of infection [PMC4102413].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUCAGUUUGUCAAAUACCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Danio rerio (zebrafish) dre-miR-223
  2. Gallus gallus gga-miR-223
  3. Gorilla gorilla gorilla ggo-miR-223 (MIR223)
  4. Gorilla gorilla ggo-miR-223
  5. Homo sapiens (human) microRNA mir-223
  6. Ictidomys tridecemlineatus miR-223
  7. Macaca mulatta mml-miR-223
  8. Monodelphis domestica mdo-miR-223-3p
  9. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72667
  10. Pan paniscus ppa-miR-223
  11. Pan troglodytes (chimpanzee) ptr-miR-223
  12. Pongo pygmaeus ppy-miR-223
  13. Rattus norvegicus rno-miR-223-3p
  14. Saguinus labiatus (red-chested mustached tamarin) sla-miR-223
  15. Sparus aurata (gilthead seabream) mir-223
  16. Sus scrofa (pig) ssc-miR-223
  17. Taeniopygia guttata (zebra finch) tgu-miR-223
  18. Takifugu rubripes (torafugu) fru-miR-223
  19. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-223
  20. Tor tambroides miR-223
  21. Xenopus laevis (African clawed frog) xla-miR-223
  22. Xenopus tropicalis (tropical clawed frog) xtr-miR-223
 Publications