v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-223 URS00000F11D1_9544

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGUCAGUUUGUCAAAUACCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Canis lupus familiaris cfa-miR-223
    2. Danio rerio (zebrafish) dre-miR-223
    3. Gallus gallus (chicken) gga-miR-223
    4. Gorilla gorilla (western gorilla) ggo-miR-223
    5. Homo sapiens microRNA mir-223
    6. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-223
    7. Monodelphis domestica (gray short-tailed opossum) mdo-miR-223-3p
    8. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72667
    9. Pan paniscus (pygmy chimpanzee) ppa-miR-223
    10. Pan troglodytes ptr-miR-223
    11. Pongo pygmaeus (Bornean orangutan) ppy-miR-223
    12. Rattus norvegicus rno-miR-223-3p
    13. Saguinus labiatus (red-chested mustached tamarin) sla-miR-223
    14. Sparus aurata (gilthead seabream) mir-223
    15. Sus scrofa (pig) ssc-miR-223
    16. Taeniopygia guttata tgu-miR-223
    17. Takifugu rubripes fru-miR-223
    18. Tetraodon nigroviridis tni-miR-223
    19. Tor tambroides miR-223
    20. Xenopus laevis xla-miR-223
    21. Xenopus tropicalis (tropical clawed frog) xtr-miR-223
    22. Gorilla gorilla gorilla None
     Publications