Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-223 URS00000F11D1_43179

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCAGUUUGUCAAAUACCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Canis lupus familiaris (dog) cfa-miR-223
  2. Danio rerio (zebrafish) dre-miR-223
  3. Gallus gallus gga-miR-223
  4. Gorilla gorilla gorilla ggo-miR-223 (MIR223)
  5. Gorilla gorilla ggo-miR-223
  6. Homo sapiens (human) microRNA mir-223
  7. Macaca mulatta mml-miR-223
  8. Monodelphis domestica mdo-miR-223-3p
  9. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72667
  10. Pan paniscus ppa-miR-223
  11. Pan troglodytes (chimpanzee) ptr-miR-223
  12. Pongo pygmaeus ppy-miR-223
  13. Rattus norvegicus rno-miR-223-3p
  14. Saguinus labiatus (red-chested mustached tamarin) sla-miR-223
  15. Sparus aurata (gilthead seabream) mir-223
  16. Sus scrofa (pig) ssc-miR-223
  17. Taeniopygia guttata (zebra finch) tgu-miR-223
  18. Takifugu rubripes (torafugu) fru-miR-223
  19. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-223
  20. Tor tambroides miR-223
  21. Xenopus laevis (African clawed frog) xla-miR-223
  22. Xenopus tropicalis (tropical clawed frog) xtr-miR-223