v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-1307 URS00000EEF5F_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCGACCGGACCUCGACCGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Gorilla gorilla gorilla ggo-miR-1307 (MIR1307)
  2. Gorilla gorilla ggo-miR-1307
  3. Homo sapiens (human) hsa-miR-1307-5p
  4. Macaca fascicularis microRNA miR-1307-5p
  5. Microcebus murinus (gray mouse lemur) mmr-miR-1307
  6. Pteropus alecto (black flying fox) pal-miR-1307-5p