Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-744 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-744 precursor URS00000EC1BE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR744: MIR744 is a non-conserved miRNA that has been discovered in one or a few species [PMC9879538]. It is involved in the post-transcriptional regulation of TGF-beta1, which plays a role in cellular processes such as proliferation, differentiation, migration, and survival [PMC3828615]. In breast cancer (BC), MIR744 has been found to be hypomethylated and up-regulated in 56% of cases [PMC3828615]. It is also activated by bortezomib-mediated activation of CEBPD [PMC8308509]. MIR744 is one of the miRNA regulators expressed in cumulus cells (CCs), along with MIR425, MIR146b, Let-7d, MIR202, and Let-7e [PMC4168028]. Interestingly, MIR202 has been identified as a potential regulator of the aging and angiogenesis-related gene HAS2 [PMC4168028]. NONO interacts with several miRNAs including MIR744 and protein-coding genes such as CELF2 and KRT8 [PMC9730017]. In addition to BC, MIR744 has also been associated with poor prognosis in nasopharyngeal carcinoma (NPC) [PMC6368411]. It has been shown to induce the expression of Cyclin B1 in mouse cell lines along with miR1186 and miR466d-3p [PMC4696257]. The 5'-flanking region of MAP2K4 (host gene of intronic MIR744) was cloned from THP-1 cells using PCR techniques [PMC5775404]. The mature sequence of MIR744 was synthesized to generate a construct that inhibits its expression for functional studies [PMC5362436].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGGCAAGGUGCGGGGCUAGGGCUAACAGCAGUCUUACUGAAGGUUUCCUGGAAACCACGCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

2D structure Publications