Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miscellaneous RNA URS00000E73CB_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUUCAGGAUAGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus bta-miR-26b
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26b
  3. Canis lupus familiaris (dog) cfa-miR-26b
  4. Capra hircus (goat) chi-miR-26b-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-26b-5p
  6. Cervus elaphus (red deer) cel-miR-26b
  7. Cricetulus griseus cgr-miR-26b-5p
  8. Dasypus novemcinctus dno-miR-26b-5p
  9. Daubentonia madagascariensis (aye-aye) dma-miR-26b
  10. Homo sapiens (human) Hsa-Mir-26-P2_5p (mature (guide))
  11. Macaca mulatta (Rhesus monkey) Mml-Mir-26-P2_5p (mature (guide))
  12. Microcebus murinus (gray mouse lemur) mmr-miR-26b
  13. Mus musculus Mmu-Mir-26-P2_5p (mature (guide))
  14. Oryctolagus cuniculus ocu-miR-26b-5p
  15. Pan paniscus ppa-miR-26b
  16. Papio hamadryas pha-miR-26b
  17. Pteropus alecto pal-miR-26b-5p
  18. Rattus norvegicus Rno-Mir-26-P2_5p (mature (guide))
  19. Sus scrofa ssc-miR-26b-5p
  20. Tupaia chinensis tch-miR-26b-5p