Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-26b URS00000E73CB_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-26b: Cfa-mir-26b is a canine microRNA that has been studied in various contexts. In a study analyzing the expression pattern of 12 canine miRNAs in chronic lymphocytic leukemia (CLL), cfa-mir-26b was one of the four miRNAs used as endogenous controls due to its stable expression [PMC3619122]. Additionally, cfa-mir-26b was selected for validation in microarray results in CLL [PMC5678797]. In adrenal cortex samples, cfa-mir-26b was part of the miRNA families with high abundance, including cfa-miR-30 and cfa-miR-7 families [PMC4768678]. In metastatic and non-metastatic mammary tumors, cfa-mir-26b showed significant differential expression [PMC7646326]. However, its expression levels were relatively low compared to other miRNAs across various cell lines [PMC8379617]. Furthermore, in veterinary patients with congestive heart failure (CHF), downregulation of cfa-mir-26b was observed in canine ventricular and atrial muscles after CHF development subsequent to experimental ventricular pacing [PMC5533140]. Overall, these studies highlight the involvement of cfa-mir-26b in different biological processes and its potential as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUUCAGGAUAGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus bta-miR-26b
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26b
  3. Capra hircus (goat) chi-miR-26b-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-26b-5p
  5. Cervus elaphus (red deer) cel-miR-26b
  6. Cricetulus griseus cgr-miR-26b-5p
  7. Dasypus novemcinctus dno-miR-26b-5p
  8. Daubentonia madagascariensis (aye-aye) dma-miR-26b
  9. Homo sapiens (human) Hsa-Mir-26-P2_5p (mature (guide))
  10. Macaca mulatta (Rhesus monkey) Mml-Mir-26-P2_5p (mature (guide))
  11. Microcebus murinus (gray mouse lemur) mmr-miR-26b
  12. Mus musculus Mmu-Mir-26-P2_5p (mature (guide))
  13. Oryctolagus cuniculus ocu-miR-26b-5p
  14. Ovis aries (sheep) miscellaneous RNA
  15. Pan paniscus ppa-miR-26b
  16. Papio hamadryas pha-miR-26b
  17. Pteropus alecto pal-miR-26b-5p
  18. Rattus norvegicus Rno-Mir-26-P2_5p (mature (guide))
  19. Sus scrofa ssc-miR-26b-5p
  20. Tupaia chinensis tch-miR-26b-5p
Publications