v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-26b-5p URS00000E73CB_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCAAGUAAUUCAGGAUAGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Bos taurus (cattle) bta-miR-26b
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26b
  3. Canis lupus familiaris cfa-miR-26b
  4. Capra hircus (goat) chi-miR-26b-5p
  5. Cavia porcellus cpo-miR-26b-5p
  6. Cervus elaphus (red deer) cel-miR-26b
  7. Cricetulus griseus cgr-miR-26b-5p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-26b-5p
  9. Daubentonia madagascariensis dma-miR-26b
  10. Homo sapiens Hsa-Mir-26-P2_5p (mature (guide))
  11. Macaca mulatta (Rhesus monkey) Mml-Mir-26-P2_5p (mature (guide))
  12. Microcebus murinus (gray mouse lemur) mmr-miR-26b
  13. Mus musculus Mmu-Mir-26-P2_5p (mature (guide))
  14. Oryctolagus cuniculus (rabbit) ocu-miR-26b-5p
  15. Ovis aries miscellaneous RNA
  16. Pan paniscus (pygmy chimpanzee) ppa-miR-26b
  17. Papio hamadryas pha-miR-26b
  18. Pteropus alecto (black flying fox) pal-miR-26b-5p
  19. Rattus norvegicus (Norway rat) Rno-Mir-26-P2_5p (mature (guide))
  20. Sus scrofa ssc-miR-26b-5p
 Publications