Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8) secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8) URS00000E5CD1_559292

Automated summary: This tRNA sequence is 75 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (GtRNAdb, ENA, IntAct). Described in 12 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8) sequence is a product of SUP6, tRNA-Tyr-GTA-1-5, tRNA-Tyr-GTA-1-4, tRNA-Tyr-GTA-1-3, SUP2, tRNA-Tyr-GTA-1-7, tRNA-Tyr-GTA-1-8, tRNA-Tyr-GTA-1-6, SUP5, SUP3, tRNA-Tyr-GTA-1-2, tRNA-Tyr-GTA-1-1, SUP8, SUP4, SUP7, SUP11 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8) interacts with:

Interaction id Participant Synonyms
EBI-12517648 P38205 D6VPX6 EBI-11933 Multisite-specific tRNA:m5C-methyltransferase NCL1 P38205 TRM4 YBL024W YBL0437 ncl1_yeast tRNA (cytosine-5-)-methyltransferase NCL1 tRNA methyltransferase 4
EBI-11701625 Q08647 D6W2U5 EBI-29265 O5254 PUS7 Q08647 RNA pseudouridylate synthase 7 RNA-uridine isomerase 7 YOR243C pus7_yeast tRNA pseudouridine(13) synthase

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUCUCGGUAGCCAAGUUGGUUUAAGGCGCAAGACUGUAAAUCUUGAGAUCGGGCGUUCGACUCGCCCCCGGGAGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 139 other species

    1. Kazachstania africana CBS 2517 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    2. Naumovozyma castellii CBS 4309 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
    3. Naumovozyma dairenensis CBS 421 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    4. Saccharomyces boulardii (nom. inval.) tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
    5. Saccharomyces cerevisiae AWRI796 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    6. Saccharomyces cerevisiae (baker's yeast) Tyr-tRNA SUP11
    7. Saccharomyces cerevisiae CBS 7960 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
    8. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    9. Saccharomyces cerevisiae CLIB215 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    10. Saccharomyces cerevisiae CLIB324 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 6)
    11. Saccharomyces cerevisiae CLIB382 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
    12. Saccharomyces cerevisiae EC1118 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    13. Saccharomyces cerevisiae EC9-8 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 6)
    14. Saccharomyces cerevisiae FL100 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
    15. Saccharomyces cerevisiae FostersB tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
    16. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    17. Saccharomyces cerevisiae Lalvin QA23 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    18. Saccharomyces cerevisiae P283 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    19. Saccharomyces cerevisiae P301 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
    20. Saccharomyces cerevisiae PE-2 tRNA-Tyr
    21. Saccharomyces cerevisiae PW5 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
    22. Saccharomyces cerevisiae R008 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 6)
    23. Saccharomyces cerevisiae R103 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    24. Saccharomyces cerevisiae RM11-1a tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    25. Saccharomyces cerevisiae Sigma1278b tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    26. Saccharomyces cerevisiae T73 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
    27. Saccharomyces cerevisiae T7 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    28. Saccharomyces cerevisiae UC5 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 5)
    29. Saccharomyces cerevisiae UFMG A-905 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
    30. Saccharomyces cerevisiae Vin13 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
    31. Saccharomyces cerevisiae VL3 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    32. Saccharomyces cerevisiae W303 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    33. Saccharomyces cerevisiae Y10 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
    34. Saccharomyces cerevisiae YJM1078 tRNA-Tyr
    35. Saccharomyces cerevisiae YJM1083 tRNA-Tyr
    36. Saccharomyces cerevisiae YJM1129 tRNA-Tyr
    37. Saccharomyces cerevisiae YJM1133 tRNA-Tyr
    38. Saccharomyces cerevisiae YJM1190 tRNA-Tyr
    39. Saccharomyces cerevisiae YJM1199 tRNA-Tyr
    40. Saccharomyces cerevisiae YJM1202 tRNA-Tyr
    41. Saccharomyces cerevisiae YJM1208 tRNA-Tyr
    42. Saccharomyces cerevisiae YJM1242 tRNA-Tyr
    43. Saccharomyces cerevisiae YJM1244 tRNA-Tyr
    44. Saccharomyces cerevisiae YJM1248 tRNA-Tyr
    45. Saccharomyces cerevisiae YJM1250 tRNA-Tyr
    46. Saccharomyces cerevisiae YJM1252 tRNA-Tyr
    47. Saccharomyces cerevisiae YJM1273 tRNA-Tyr
    48. Saccharomyces cerevisiae YJM1304 tRNA-Tyr
    49. Saccharomyces cerevisiae YJM1307 tRNA-Tyr
    50. Saccharomyces cerevisiae YJM1311 tRNA-Tyr
    51. Saccharomyces cerevisiae YJM1326 tRNA-Tyr
    52. Saccharomyces cerevisiae YJM1332 tRNA-Tyr
    53. Saccharomyces cerevisiae YJM1336 tRNA-Tyr
    54. Saccharomyces cerevisiae YJM1338 tRNA-Tyr
    55. Saccharomyces cerevisiae YJM1341 tRNA-Tyr
    56. Saccharomyces cerevisiae YJM1342 tRNA-Tyr
    57. Saccharomyces cerevisiae YJM1355 tRNA-Tyr
    58. Saccharomyces cerevisiae YJM1356 tRNA-Tyr
    59. Saccharomyces cerevisiae YJM1381 tRNA-Tyr
    60. Saccharomyces cerevisiae YJM1383 tRNA-Tyr
    61. Saccharomyces cerevisiae YJM1385 tRNA-Tyr
    62. Saccharomyces cerevisiae YJM1386 tRNA-Tyr
    63. Saccharomyces cerevisiae YJM1387 tRNA-Tyr
    64. Saccharomyces cerevisiae YJM1388 tRNA-Tyr
    65. Saccharomyces cerevisiae YJM1389 tRNA-Tyr
    66. Saccharomyces cerevisiae YJM1399 tRNA-Tyr
    67. Saccharomyces cerevisiae YJM1400 tRNA-Tyr
    68. Saccharomyces cerevisiae YJM1401 tRNA-Tyr
    69. Saccharomyces cerevisiae YJM1402 tRNA-Tyr
    70. Saccharomyces cerevisiae YJM1415 tRNA-Tyr
    71. Saccharomyces cerevisiae YJM1417 tRNA-Tyr
    72. Saccharomyces cerevisiae YJM1418 tRNA-Tyr
    73. Saccharomyces cerevisiae YJM1419 tRNA-Tyr
    74. Saccharomyces cerevisiae YJM1433 tRNA-Tyr
    75. Saccharomyces cerevisiae YJM1434 tRNA-Tyr
    76. Saccharomyces cerevisiae YJM1439 tRNA-Tyr
    77. Saccharomyces cerevisiae YJM1443 tRNA-Tyr
    78. Saccharomyces cerevisiae YJM1444 tRNA-Tyr
    79. Saccharomyces cerevisiae YJM1447 tRNA-Tyr
    80. Saccharomyces cerevisiae YJM1450 tRNA-Tyr
    81. Saccharomyces cerevisiae YJM1460 tRNA-Tyr
    82. Saccharomyces cerevisiae YJM1463 tRNA-Tyr
    83. Saccharomyces cerevisiae YJM1477 tRNA-Tyr
    84. Saccharomyces cerevisiae YJM1478 tRNA-Tyr
    85. Saccharomyces cerevisiae YJM1479 tRNA-Tyr
    86. Saccharomyces cerevisiae YJM1526 tRNA-Tyr
    87. Saccharomyces cerevisiae YJM1527 tRNA-Tyr
    88. Saccharomyces cerevisiae YJM1549 tRNA-Tyr
    89. Saccharomyces cerevisiae YJM1573 tRNA-Tyr
    90. Saccharomyces cerevisiae YJM1574 tRNA-Tyr
    91. Saccharomyces cerevisiae YJM1592 tRNA-Tyr
    92. Saccharomyces cerevisiae YJM1615 tRNA-Tyr
    93. Saccharomyces cerevisiae YJM189 tRNA-Tyr
    94. Saccharomyces cerevisiae YJM193 tRNA-Tyr
    95. Saccharomyces cerevisiae YJM195 tRNA-Tyr
    96. Saccharomyces cerevisiae YJM244 tRNA-Tyr
    97. Saccharomyces cerevisiae YJM248 tRNA-Tyr
    98. Saccharomyces cerevisiae YJM269 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    99. Saccharomyces cerevisiae YJM270 tRNA-Tyr
    100. Saccharomyces cerevisiae YJM271 tRNA-Tyr
    101. Saccharomyces cerevisiae YJM320 tRNA-Tyr
    102. Saccharomyces cerevisiae YJM326 tRNA-Tyr
    103. Saccharomyces cerevisiae YJM428 tRNA-Tyr
    104. Saccharomyces cerevisiae YJM450 tRNA-Tyr
    105. Saccharomyces cerevisiae YJM451 tRNA-Tyr
    106. Saccharomyces cerevisiae YJM453 tRNA-Tyr
    107. Saccharomyces cerevisiae YJM456 tRNA-Tyr
    108. Saccharomyces cerevisiae YJM470 tRNA-Tyr
    109. Saccharomyces cerevisiae YJM541 tRNA-Tyr
    110. Saccharomyces cerevisiae YJM554 tRNA-Tyr
    111. Saccharomyces cerevisiae YJM555 tRNA-Tyr
    112. Saccharomyces cerevisiae YJM627 tRNA-Tyr
    113. Saccharomyces cerevisiae YJM681 tRNA-Tyr
    114. Saccharomyces cerevisiae YJM682 tRNA-Tyr
    115. Saccharomyces cerevisiae YJM683 tRNA-Tyr
    116. Saccharomyces cerevisiae YJM689 tRNA-Tyr
    117. Saccharomyces cerevisiae YJM693 tRNA-Tyr
    118. Saccharomyces cerevisiae YJM969 tRNA-Tyr
    119. Saccharomyces cerevisiae YJM972 tRNA-Tyr
    120. Saccharomyces cerevisiae YJM975 tRNA-Tyr
    121. Saccharomyces cerevisiae YJM978 tRNA-Tyr
    122. Saccharomyces cerevisiae YJM981 tRNA-Tyr
    123. Saccharomyces cerevisiae YJM984 tRNA-Tyr
    124. Saccharomyces cerevisiae YJM987 tRNA-Tyr
    125. Saccharomyces cerevisiae YJM990 tRNA-Tyr
    126. Saccharomyces cerevisiae YJM993 tRNA-Tyr
    127. Saccharomyces cerevisiae YJM996 tRNA-Tyr
    128. Saccharomyces cerevisiae YJSH1 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    129. Tetrapisispora blattae CBS 6284 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    130. Tetrapisispora phaffii CBS 4417 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 6)
    131. Vanderwaltozyma polyspora DSM 70294 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    132. Wickerhamomyces anomalus NRRL Y-366 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
    2D structure New