v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-208-3p URS00000E5433_9258

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUAAGACGAGCAAAAAGCUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Anolis carolinensis aca-miR-208-3p
  2. Bos taurus (cattle) bta-miR-208a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-208a
  4. Canis lupus familiaris cfa-miR-208a
  5. Cavia porcellus cpo-miR-208a-3p
  6. Chrysemys picta bellii Cpi-Mir-208-P2_3p (mature (guide))
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-208a-3p
  8. Echinops telfairi Ete-Mir-208-P2_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-208a
  10. Gekko japonicus Gja-Mir-208-P2_3p (mature (guide))
  11. Homo sapiens hsa-miR-208a-3p
  12. Macaca mulatta (Rhesus monkey) mml-miR-208a-3p
  13. Mus musculus mmu-miR-208a-3p
  14. Ophiophagus hannah (king cobra) oha-miR-208-3p
  15. Oryctolagus cuniculus (rabbit) ocu-miR-208a-3p
  16. Pan troglodytes ptr-miR-208a
  17. Pongo pygmaeus ppy-miR-208a
  18. Pteropus alecto (black flying fox) pal-miR-208a-3p
  19. Python bivittatus Pbv-Mir-208-P2_3p (mature (guide))
  20. Rattus norvegicus (Norway rat) Rno-Mir-208-P2_3p (mature (guide))
  21. Sarcophilus harrisii Sha-Mir-208-P2_3p (mature (guide))
 Publications