Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-193b URS00000E1DC5_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-193b: Cfa-mir-193b is a miRNA that is ubiquitously expressed in dogs, including the liver [PMC4989286]. In dogs with liver injury, the serum levels of cfa-mir-193b were elevated [PMC4989286]. Serum analysis also revealed the presence of other miRNA biomarkers for various tissues, such as cfa-miR-122 and -885 for the liver, cfa-miR-1, -133, and -206 for the heart/muscle, miR-34b/c for the testis, cfa-miR-216 for the pancreas, and cfa-miR-212 for the brain [PMC4989286]. The up-regulation of cfa-mir-193b in response to T. canis infection may enhance the host immune response and contribute to host resistance against infection [PMC9773451]. At 24 hours post-infection (hpi), four differentially expressed miRNAs were identified as potential regulators of 48 target genes. Among them were cfa-miR-122 and cfa-mir-193b [PMC9773451]. In this study, cd22 was predicted as a potential target gene for cfa-mir-193b [PMC9773451]. Additionally, other miRNAs such as novel_328 and cfa-miR-331 were found to be associated with host immune response [PMC9773451]. Overall, these findings suggest that elevated levels of cfa-mir-193b may play a role in regulating immune responses and potential target genes in dogs with liver injury or T. canis infection.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGGUUUUGAGGGCGAGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus Bta-Mir-193-P1a_5p (mature (co-guide))
  2. Capra hircus (goat) chi-miR-193b-5p
  3. Cavia porcellus (domestic guinea pig) cpo-miR-193b-5p
  4. Cervus elaphus (red deer) cel-miR-193b
  5. Cricetulus griseus cgr-miR-193b-5p
  6. Dasypus novemcinctus dno-miR-193b-5p
  7. Gorilla gorilla gorilla ggo-miR-193b (MIR193B)
  8. Gorilla gorilla ggo-miR-193b
  9. Homo sapiens (human) hsa-miR-193b-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-193b-5p
  11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-193b-5p
  12. Mus musculus mmu-miR-193b-5p
  13. Ornithorhynchus anatinus oan-miR-193-5p
  14. Oryctolagus cuniculus ocu-miR-193b-5p
  15. Pteropus alecto pal-miR-193b-5p
Publications