v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-193b-5p URS00000E1DC5_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGGGUUUUGAGGGCGAGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Bos taurus (cattle) Bta-Mir-193-P1a_5p (mature (co-guide))
  2. Canis lupus familiaris cfa-miR-193b
  3. Capra hircus (goat) chi-miR-193b-5p
  4. Cavia porcellus cpo-miR-193b-5p
  5. Cervus elaphus (red deer) cel-miR-193b
  6. Cricetulus griseus cgr-miR-193b-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-193b-5p
  8. Gorilla gorilla gorilla ggo-miR-193b (MIR193B)
  9. Gorilla gorilla ggo-miR-193b
  10. Macaca mulatta (Rhesus monkey) mml-miR-193b-5p
  11. Monodelphis domestica mdo-miR-193b-5p
  12. Mus musculus mmu-miR-193b-5p
  13. Ornithorhynchus anatinus oan-miR-193-5p
  14. Oryctolagus cuniculus (rabbit) ocu-miR-193b-5p
  15. Pteropus alecto (black flying fox) pal-miR-193b-5p
 Publications