v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-188-5p URS00000DE63C_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAUCCCUUGCAUGGUGGAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Bos taurus bta-miR-188
  2. Canis lupus familiaris cfa-miR-188
  3. Cavia porcellus (domestic guinea pig) Cpo-Mir-188-P1_5p (mature (co-guide))
  4. Dasypus novemcinctus Dno-Mir-188-P1_5p (mature (guide))
  5. Eptesicus fuscus efu-miR-188
  6. Homo sapiens Hsa-Mir-188-P1_5p (mature (guide))
  7. Macaca mulatta mml-miR-188-5p
  8. Macaca nemestrina mne-miR-188
  9. Mus musculus (house mouse) Mmu-Mir-188-P1_5p (mature (guide))
  10. Oryctolagus cuniculus (rabbit) Ocu-Mir-188-P1_5p (mature (guide))
  11. Pan paniscus (pygmy chimpanzee) ppa-miR-188
  12. Pan troglodytes ptr-miR-188
  13. Pongo pygmaeus ppy-miR-188
  14. Sus scrofa ssc-mir11
 Publications