Homo sapiens (human) microRNA hsa-mir-93 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-93 precursor URS00000DDD35_9606

80 nucleotides
8 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
Found in 2 other species
7928 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR93: MIR93 is a microRNA that exhibits upregulated expression levels despite having strongly hypermethylated promoters [PMC4198682]. In a study examining patients with MHT, MIR93, along with miR191, was analyzed using the logistic regression analysis forward method to determine if these parameters could predict abnormal CT findings [PMC7430915].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUUACCCAACCUACUGCUGAGCUAGCACUUCCCGAGCCCCCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.