Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) UXT antisense RNA 1 (UXT-AS1) URS00000DDB0D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

UXT-AS1: UXT-AS1 is a long non-coding RNA (lncRNA) that has been studied for its clinical significance and functional mechanisms in various cancers [1]. Specifically, in the context of pancreatic ductal adenocarcinoma (PDAC), UXT-AS1 has been identified as a potential prognostic biomarker [1]. This suggests that the expression level of UXT-AS1 could potentially be used to predict the outcome and prognosis of PDAC patients. Additionally, two potential UXT-AS1 targeted drugs have been identified for PDAC treatment, which could potentially improve the efficacy of treatment for this type of cancer [1]. These findings highlight the potential importance of UXT-AS1 in PDAC and its potential as a therapeutic target. Further research is needed to fully understand the functional mechanisms and clinical implications of UXT-AS1 in cancer. References: [1] Li, Y., Zhang, J., Huo, C., Ding, N., Li, J., Xiao, J., ... & Wang, L. (2021). UXT-AS1 promotes pancreatic ductal adenocarcinoma progression by sponging miR-129-5p and upregulating SOX4 expression. Cancer Cell International, 21(1), 1-12. [PMC7974525]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGUCCCGCUGCAGCACGUCACUGAUGAAGGUCUCGUAGCGCAGCACUUUCUCCCCCGUGGCCUCCACCGCCCGCCGCUUAGGGGGCGUCGCCAUGAUGGGCUCCUGGGGAGUGGGGAGGGGGAAGACCAUGUUGACCGAUCCAGUUUGGCCUCACACACAGUUCAUCUCUACCCUCUCAACGCUGGGAAUCGGCUUGUCCGGCUCAAGCUGGAGGUUCAGCCUUCCGCCCCUCCCAACUCGGGGACCCGACCACCCAGGGACACCCAAGCGCGGCCUUUACCUCAGGCCGCCAGCAAUAAGAACGGUUGGUAGGAACCGCGGCUUCCGGGUGGCGCGGGUGAAUGACGUUAGAUUUUCAAACAAGAACUUAUAACCCAGCAAGAAUGGGCCUUUGCCUGGAGAAGAAUCCAGACCAUGGGAUGAAUCCCCAAAUGCUAUUUCCAUCUGUAGAGCCUAGAGCACCCACCCCUACCAAGGAAGUCUUCCCAGAUAAUUUGUGUUUCAUAUGUAAAAGCAAGUUUUUUUUUUCAAAUGCUCAAAACCCAAGCAAGUUAAGCCCUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications