Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-181a precursor (ppa-mir-181a-2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-181a precursor (ppa-mir-181a-2) URS00000DD591_9597

110 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 5 other species
2 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Homo sapiens microRNA hsa-mir-181a precursor (hsa-mir-181a-2)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 181a-2 (ENSNLEG00000022006.2)
Pan troglodytes microRNA ptr-mir-181a precursor (ptr-mir-181a-2)
Pongo abelii miRNA (ENSPPYG00000021883.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-181a precursor (ppy-mir-181a-2)

2D structure

Publications