Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) testis expressed transcript, Y-linked 13 (TTTY13) URS00000DBA4C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTTY13: TTTY13 is a long noncoding gene located in the male-specific region of the Y chromosome. It has been found to be involved in the prognosis of multiple cancers, including gastric cancer and laryngeal squamous cell carcinoma [PMC8920452]. In a study, 10 optimal differentially methylated genes (DMGs) and 6 optimal differentially methylated long noncoding RNAs (DM-lncRNAs) were identified, including TTTY13, which were used to construct methylation status-based or methylation level-based risk score systems [PMC7255475]. The Yq11 region of the Y chromosome contains the azoospermia factor (AZF) locus, which is associated with fertility issues. The AZFb region within Yq11 includes genes such as TTTY13 and TTTY14 [PMC9023810]. Age has been found to be associated with methylation levels of specific CpGs annotated to TTTY13 [PMC8920452]. In addition, other CpGs in genes such as DDX3Y, EIF1AY, and TTTY13 have also been associated with aging [PMC8920452]. These findings suggest that TTTY13 and other genes in the male-specific region of the Y chromosome play a role in cancer prognosis and age-related changes in methylation levels.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAUGAUCCACAGAAAAAUAAAAAAACAUGGAGCCCCAGAGCCCAAGCAGAGCCAAACAGACAAGCAACCAAAAUAAAAGUUGAAGUUGUGGGAUCUCAUCCAAUUCCCACCAGAUUGUAUCCUCACCCCUGUCUGACCUUAUUGUUGCUCACACUCUAUGUCCCAAAAUGAAAACCCAAGACGAUGGAGUAUUGCCCCCUUAUGAUGUGAACCAACUGCUUGGCUGGGACCUGAAUUUGAGUUUAUUCCUAGGGCUCUGUUUGAUGUUACUUCUGGCUGGCUCAUGUCUGCCCUCUCCUGGGAUCACGGGACUAUCCCAUGGAUCCAACAGAGAAGACAGGUGAAGUUGCUGGAACCCAUUCUCCAUUCAGCAGAUUGUAUCCUCACCCCAUGUGACCUUAUUGCUGCUCAGACUCUAUGUUCCAGGAUAAAAUCCCAAGAAGAUGGAGAAGUGCAUCCCUCAUGAUGUGAAGCAUGUGCGCAGCUGGGAACCAAAUUCGAGAGCUCACAGUUUGAAUAGAAGAAUCCAAAGCUACAACAGCAGCAGCAGCUAUAGCUGUGACCGCUAUGAGGCCCGUGAUGACAGCUAUUAAGGGAGACUCACCACCAAGGGGAUUACCACCAUCGUAGCUACCAUUAGAUUACUGGUGGUCAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications