Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tetraodon nigroviridis (spotted green pufferfish) tni-miR-196a URS00000DA6A7_99883

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Tetraodon nigroviridis. Annotated by 2 databases (miRBase, MirGeneDB). Found in the Tetraodon nigroviridis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGGUAGUUUCAUGUUGUUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 54 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-196-P3_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-196-P1_5p (mature (guide))
    3. Ateles geoffroyi age-miR-196
    4. Bos taurus (cattle) bta-miR-196a
    5. Callorhinchus milii Cmi-Mir-196-P4_5p (mature (guide))
    6. Canis lupus familiaris (dog) cfa-miR-196a
    7. Cavia porcellus cpo-miR-196a-5p
    8. Chiloscyllium plagiosum microRNA cpl-miR-196a
    9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-196-P3_5p (mature (guide))
    10. Chrysemys picta cpi-miR-196-5p
    11. Columba livia (rock pigeon) cli-miR-196-5p
    12. Cricetulus griseus (Chinese hamster) cgr-miR-196a-5p
    13. Cyprinus carpio ccr-miR-196a
    14. Danio rerio (zebrafish) dre-miR-196a-5p
    15. Daubentonia madagascariensis (aye-aye) dma-miR-196
    16. Eptatretus burgeri Ebu-Mir-196-P5_5p (mature (guide))
    17. Equus caballus (horse) eca-miR-196a
    18. Gadus morhua (Atlantic cod) gmo-miR-196a-5p
    19. Gallus gallus Gga-Mir-196-P3_5p (mature (guide))
    20. Gekko japonicus Gja-Mir-196-P1_5p (mature (guide))
    21. Gorilla gorilla (western gorilla) microRNA mir-196-2
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-196a
    23. Homo sapiens hsa-miR-196a-5p
    24. Lagothrix lagotricha lla-miR-196
    25. Latimeria chalumnae (coelacanth) Lch-Mir-196-P3_5p (mature (guide))
    26. Lepisosteus oculatus Loc-Mir-196-P3_5p (mature (guide))
    27. Lethenteron camtschaticum (Arctic lamprey) miR-196
    28. Macaca mulatta Mml-Mir-196-P3_5p (mature (guide))
    29. Maylandia zebra mze-miR-196a
    30. Microcaecilia unicolor Mun-Mir-196-P1_5p (mature (guide))
    31. Monopterus albus Mal-Mir-196-P4a_5p (mature (guide))
    32. Mus musculus (house mouse) mmu-miR-196a-5p
    33. Neolamprologus brichardi nbr-miR-196a
    34. Ophiophagus hannah (king cobra) oha-miR-196b-5p
    35. Oreochromis niloticus (Nile tilapia) oni-miR-196a
    36. Ornithorhynchus anatinus oan-miR-196a-5p
    37. Oryctolagus cuniculus ocu-miR-196a-5p
    38. Otolemur garnettii (small-eared galago) oga-miR-196a
    39. Pan paniscus ppa-miR-196
    40. Pan troglodytes ptr-miR-196a
    41. Papio hamadryas pha-miR-196a
    42. Petromyzon marinus (sea lamprey) pma-miR-196a-5p
    43. Pongo pygmaeus (Bornean orangutan) ppy-miR-196-2
    44. Pundamilia nyererei pny-miR-196a
    45. Rattus norvegicus rno-miR-196a-5p
    46. Salmo salar ssa-miR-196a-5p
    47. Scyliorhinus torazame (cloudy catshark) Sto-Mir-196-P3_5p (mature (guide))
    48. Sphenodon punctatus Spt-Mir-196-P1_5p (mature (guide))
    49. Sus scrofa ssc-miR-196a
    50. Taeniopygia guttata Tgu-Mir-196-P1_5p (mature (guide))
    51. Takifugu rubripes fru-miR-196a
    52. Tor tambroides (Thai mahseer) miR-196a-5p
    53. Xenopus laevis (African clawed frog) Xla-Mir-196-P4c-v1_5p (mature (guide))
    54. Xenopus tropicalis Xtr-Mir-196-P4_5p (mature (guide))