Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-196a-5p URS00000DA6A7_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 3 databases (RefSeq, ENA, miRBase). Described in 11 papers. Danio rerio (zebrafish) dre-miR-196a-5p sequence is a product of dre-miR-196a-5p, miR-196, miR-196a-5p, mirn196a-1, miR-196a, 196, dre-miR-196a, mirn196a-2, mir196a-1, mir196a-2, 196a genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGGUAGUUUCAUGUUGUUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 102 other species

    1. Alligator mississippiensis Ami-Mir-196-P2_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-196-P3_5p (mature (guide))
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-196
    4. Bos taurus (cattle) bta-miR-196a
    5. Callorhinchus milii (elephant shark) miR-196b
    6. Canis lupus familiaris cfa-miR-196a
    7. Cavia porcellus (domestic guinea pig) cpo-miR-196a-5p
    8. Chiloscyllium plagiosum microRNA cpl-miR-196a
    9. Chrysemys picta bellii Cpi-Mir-196-P1_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-miR-196-5p
    11. Columba livia (rock pigeon) cli-miR-196-5p
    12. Cricetulus griseus cgr-miR-196a-5p
    13. Cyprinus carpio ccr-miR-196a
    14. Daubentonia madagascariensis (aye-aye) dma-miR-196
    15. Eptatretus burgeri miR-196IV
    16. Equus caballus (horse) eca-miR-196a
    17. Gadus morhua gmo-miR-196a-5p
    18. Gallus gallus (chicken) Gga-Mir-196-P3f_5p (mature (guide))
    19. Gorilla gorilla (western gorilla) microRNA mir-196-2
    20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-196a
    21. Homo sapiens hsa-miR-196a-5p
    22. Lagothrix lagotricha lla-miR-196
    23. Lethenteron camtschaticum (Arctic lamprey) miR-196
    24. Macaca mulatta Mml-Mir-196-P1_5p (mature (guide))
    25. Maylandia zebra mze-miR-196a
    26. Mus musculus (house mouse) mmu-miR-196a-5p
    27. Neolamprologus brichardi nbr-miR-196a
    28. Ophiophagus hannah oha-miR-196b-5p
    29. Oreochromis niloticus oni-miR-196a
    30. Ornithorhynchus anatinus oan-miR-196a-5p
    31. Oryctolagus cuniculus (rabbit) ocu-miR-196a-5p
    32. Otolemur garnettii oga-miR-196a
    33. Pan paniscus ppa-miR-196
    34. Pan troglodytes (chimpanzee) ptr-miR-196a
    35. Papio hamadryas (hamadryas baboon) pha-miR-196a
    36. Petromyzon marinus pma-miR-196a-5p
    37. Pongo pygmaeus ppy-miR-196-2
    38. Pundamilia nyererei pny-miR-196a
    39. Rattus norvegicus rno-miR-196a-5p
    40. Salmo salar (Atlantic salmon) ssa-miR-196a-5p
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-196-P3_5p (mature (guide))
    42. Sus scrofa ssc-miR-196a
    43. Taeniopygia guttata (zebra finch) Tgu-Mir-196-P3_5p (mature (guide))
    44. Takifugu rubripes (torafugu) fru-miR-196a
    45. Tetraodon nigroviridis tni-miR-196a
    46. Tor tambroides miR-196a-5p
    47. Xenopus tropicalis Xtr-Mir-196-P2_5p (mature (guide))