Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) Tgu-Mir-196-P1_5p (mature (guide)) URS00000DA6A7_59729

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGGUAGUUUCAUGUUGUUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 108 other species

    1. Alligator mississippiensis Ami-Mir-196-P3_5p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Mir-196-P1_5p (mature (guide))
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-196
    4. Bos taurus bta-miR-196a
    5. Callorhinchus milii Cmi-Mir-196-P4_5p (mature (guide))
    6. Canis lupus familiaris cfa-miR-196a
    7. Cavia porcellus cpo-miR-196a-5p
    8. Chiloscyllium plagiosum microRNA cpl-miR-196a
    9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-196-P3_5p (mature (guide))
    10. Chrysemys picta cpi-miR-196-5p
    11. Columba livia cli-miR-196-5p
    12. Cricetulus griseus (Chinese hamster) cgr-miR-196a-5p
    13. Cyprinus carpio ccr-miR-196a
    14. Danio rerio dre-miR-196a-5p
    15. Daubentonia madagascariensis dma-miR-196
    16. Eptatretus burgeri (inshore hagfish) Ebu-Mir-196-P5_5p (mature (guide))
    17. Equus caballus (horse) eca-miR-196a
    18. Gadus morhua gmo-miR-196a-5p
    19. Gallus gallus Gga-Mir-196-P3_5p (mature (guide))
    20. Gekko japonicus Gja-Mir-196-P1_5p (mature (guide))
    21. Gorilla gorilla microRNA mir-196-2
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-196a
    23. Homo sapiens hsa-miR-196a-5p
    24. Lagothrix lagotricha lla-miR-196
    25. Latimeria chalumnae (coelacanth) Lch-Mir-196-P3_5p (mature (guide))
    26. Lepisosteus oculatus Loc-Mir-196-P3_5p (mature (guide))
    27. Lethenteron camtschaticum (Arctic lamprey) miR-196
    28. Macaca mulatta (Rhesus monkey) Mml-Mir-196-P3_5p (mature (guide))
    29. Maylandia zebra mze-miR-196a
    30. Microcaecilia unicolor Mun-Mir-196-P1_5p (mature (guide))
    31. Monopterus albus Mal-Mir-196-P4a_5p (mature (guide))
    32. Mus musculus mmu-miR-196a-5p
    33. Neolamprologus brichardi nbr-miR-196a
    34. Ophiophagus hannah oha-miR-196b-5p
    35. Oreochromis niloticus oni-miR-196a
    36. Ornithorhynchus anatinus (platypus) oan-miR-196a-5p
    37. Oryctolagus cuniculus (rabbit) ocu-miR-196a-5p
    38. Otolemur garnettii (small-eared galago) oga-miR-196a
    39. Pan paniscus ppa-miR-196
    40. Pan troglodytes ptr-miR-196a
    41. Papio hamadryas pha-miR-196a
    42. Petromyzon marinus (sea lamprey) pma-miR-196a-5p
    43. Pongo pygmaeus (Bornean orangutan) ppy-miR-196-2
    44. Pundamilia nyererei pny-miR-196a
    45. Rattus norvegicus (Norway rat) rno-miR-196a-5p
    46. Salmo salar (Atlantic salmon) ssa-miR-196a-5p
    47. Scyliorhinus torazame (cloudy catshark) Sto-Mir-196-P3_5p (mature (guide))
    48. Sphenodon punctatus Spt-Mir-196-P1_5p (mature (guide))
    49. Sus scrofa (pig) ssc-miR-196a
    50. Takifugu rubripes (torafugu) fru-miR-196a
    51. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-196a
    52. Tor tambroides miR-196a-5p
    53. Xenopus laevis Xla-Mir-196-P4c-v1_5p (mature (guide))
    54. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-196-P4_5p (mature (guide))