Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pundamilia nyererei pny-miR-196a URS00000DA6A7_303518

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUAGUUUCAUGUUGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 108 other species

  1. Alligator mississippiensis Ami-Mir-196-P3_5p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-196-P1_5p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-196
  4. Bos taurus bta-miR-196a
  5. Callorhinchus milii Cmi-Mir-196-P4_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-196a
  7. Cavia porcellus (domestic guinea pig) cpo-miR-196a-5p
  8. Chiloscyllium plagiosum microRNA cpl-miR-196a
  9. Chrysemys picta bellii Cpi-Mir-196-P3_5p (mature (guide))
  10. Chrysemys picta cpi-miR-196-5p
  11. Columba livia (rock pigeon) cli-miR-196-5p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-196a-5p
  13. Cyprinus carpio (common carp) ccr-miR-196a
  14. Danio rerio (zebrafish) dre-miR-196a-5p
  15. Daubentonia madagascariensis (aye-aye) dma-miR-196
  16. Eptatretus burgeri (inshore hagfish) Ebu-Mir-196-P5_5p (mature (guide))
  17. Equus caballus eca-miR-196a
  18. Gadus morhua (Atlantic cod) gmo-miR-196a-5p
  19. Gallus gallus Gga-Mir-196-P3_5p (mature (guide))
  20. Gekko japonicus Gja-Mir-196-P1_5p (mature (guide))
  21. Gorilla gorilla (western gorilla) microRNA mir-196-2
  22. Haplochromis burtoni abu-miR-196a
  23. Homo sapiens (human) hsa-miR-196a-5p
  24. Lagothrix lagotricha lla-miR-196
  25. Latimeria chalumnae (coelacanth) Lch-Mir-196-P3_5p (mature (guide))
  26. Lepisosteus oculatus Loc-Mir-196-P3_5p (mature (guide))
  27. Lethenteron camtschaticum (Arctic lamprey) miR-196
  28. Macaca mulatta (Rhesus monkey) Mml-Mir-196-P3_5p (mature (guide))
  29. Maylandia zebra (zebra mbuna) mze-miR-196a
  30. Microcaecilia unicolor Mun-Mir-196-P1_5p (mature (guide))
  31. Monopterus albus (swamp eel) Mal-Mir-196-P4a_5p (mature (guide))
  32. Mus musculus mmu-miR-196a-5p
  33. Neolamprologus brichardi nbr-miR-196a
  34. Ophiophagus hannah (king cobra) oha-miR-196b-5p
  35. Oreochromis niloticus (Nile tilapia) oni-miR-196a
  36. Ornithorhynchus anatinus (platypus) oan-miR-196a-5p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-196a-5p
  38. Otolemur garnettii oga-miR-196a
  39. Pan paniscus ppa-miR-196
  40. Pan troglodytes ptr-miR-196a
  41. Papio hamadryas (hamadryas baboon) pha-miR-196a
  42. Petromyzon marinus (sea lamprey) pma-miR-196a-5p
  43. Pongo pygmaeus ppy-miR-196-2
  44. Rattus norvegicus rno-miR-196a-5p
  45. Salmo salar ssa-miR-196a-5p
  46. Scyliorhinus torazame (cloudy catshark) Sto-Mir-196-P3_5p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-196-P1_5p (mature (guide))
  48. Sus scrofa ssc-miR-196a
  49. Taeniopygia guttata Tgu-Mir-196-P1_5p (mature (guide))
  50. Takifugu rubripes (torafugu) fru-miR-196a
  51. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-196a
  52. Tor tambroides (Thai mahseer) miR-196a-5p
  53. Xenopus laevis (African clawed frog) Xla-Mir-196-P4c-v1_5p (mature (guide))
  54. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-196-P4_5p (mature (guide))