Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-99a-3p URS00000D9A15_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-99a: Mmu-mir-99a is a microRNA that has been investigated for its role in cardiomyogenesis using an overexpression strategy in murine embryonic stem cells [PMC5605795]. It is a member of the miR-99 family, along with mmu-miR-100 [PMC3665798]. Mmu-mir-99a, along with mmu-let-7c, is expressed in Ba/F3 cells, while miR-125b is not expressed [PMC2811577]. During the early phase of wound healing, a 9-microRNA group that includes mmu-mir-99a (cluster X) was down-regulated compared to unwounded skin and returned to basal levels during the later phase of wound healing [PMC3665798]. This differential expression of mmu-mir-99a during wound healing was confirmed by quantitative RT-PCR in additional animals [PMC3665798]. The study used Applied Biosystems TaqMan® miRNA assays to analyze the expression levels of various microRNAs, including mmu-mir-99a and mmu-miR-100 [PMC3665798][PMC4077261]. References: 1. PMC5605795 2. PMC2811577 3. PMC3665798 4. PMC4077261

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGCUCGUUUCUAUGGGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications